[FEATURE] Make seqan3::align_cfg::method_global a config element.

Author: smehringer

doc/tutorial/pairwise_alignment/pa_assignment_3_solution.cpp

@@ -27,7 +27,7 @@ int main()
     }
 
     // Configure the alignment kernel.
-    auto config = seqan3::align_cfg::method_global |
+    auto config = seqan3::align_cfg::method_global{} |
                   seqan3::align_cfg::scoring{seqan3::aminoacid_scoring_scheme{
                       seqan3::aminoacid_similarity_matrix::BLOSUM62}} |
                   seqan3::align_cfg::aligned_ends{seqan3::free_ends_second};

doc/tutorial/pairwise_alignment/pairwise_alignment_first_global.cpp

@@ -13,7 +13,7 @@ int main()
     seqan3::dna4_vector s2 = "ACGAAGACCGAT"_dna4;
 
     // Configure the alignment kernel.
-    auto config = seqan3::align_cfg::method_global |
+    auto config = seqan3::align_cfg::method_global{} |
                   seqan3::align_cfg::scoring{seqan3::nucleotide_scoring_scheme{}};
 
     // Invoke the pairwise alignment which returns a lazy range over alignment results.

doc/tutorial/pairwise_alignment/pairwise_alignment_solution_1.cpp

@@ -17,7 +17,7 @@ int main()
                     "AGGTACGAGCGACACT"_dna4};
 
     // Configure the alignment kernel.
-    auto config = seqan3::align_cfg::method_global |
+    auto config = seqan3::align_cfg::method_global{} |
                   seqan3::align_cfg::scoring{seqan3::nucleotide_scoring_scheme{}};
 
     for (auto const & res : seqan3::align_pairwise(seqan3::views::pairwise_combine(vec), config))

doc/tutorial/pairwise_alignment/pairwise_alignment_solution_2.cpp

@@ -17,7 +17,7 @@ int main()
                     "AGGTACGAGCGACACT"_dna4};
 
     // Configure the alignment kernel.
-    auto config = seqan3::align_cfg::method_global |
+    auto config = seqan3::align_cfg::method_global{} |
                   seqan3::align_cfg::scoring{seqan3::nucleotide_scoring_scheme{}} |
                   seqan3::align_cfg::aligned_ends{seqan3::free_ends_first};
 

doc/tutorial/pairwise_alignment/pairwise_alignment_solution_3.cpp

@@ -13,7 +13,7 @@ int main()
     auto seq2 = "AFLPGWQEENKLSKIWMKDCGCLW"_aa27;
 
     // Configure the alignment kernel.
-    auto config = seqan3::align_cfg::method_global |
+    auto config = seqan3::align_cfg::method_global{} |
                   seqan3::align_cfg::scoring{seqan3::aminoacid_scoring_scheme{
                       seqan3::aminoacid_similarity_matrix::BLOSUM62}} |
                   seqan3::align_cfg::gap{seqan3::gap_scheme{seqan3::gap_score{-2}, seqan3::gap_open_score{-9}}};

doc/tutorial/pairwise_alignment/pairwise_alignment_solution_4.cpp

@@ -13,7 +13,7 @@ int main()
     auto seq2 = "GGACGACATGACGTACGACTTTACGTACGACTAGC"_dna4;
 
     // Configure the alignment kernel.
-    auto config = seqan3::align_cfg::method_global |
+    auto config = seqan3::align_cfg::method_global{} |
                   seqan3::align_cfg::scoring{seqan3::nucleotide_scoring_scheme{
                       seqan3::match_score{4}, seqan3::mismatch_score{-2}}} |
                   seqan3::align_cfg::gap{seqan3::gap_scheme{seqan3::gap_score{-4}}} |

doc/tutorial/pairwise_alignment/pairwise_alignment_solution_5.cpp

@@ -13,7 +13,7 @@ int main()
     auto seq2 = "GGACGACATGACGTACGACTTTACGTACGACTAGC"_dna4;
 
     // Configure the alignment kernel.
-    auto config = seqan3::align_cfg::method_global |
+    auto config = seqan3::align_cfg::method_global{} |
                   seqan3::align_cfg::scoring{seqan3::nucleotide_scoring_scheme{
                       seqan3::match_score{4}, seqan3::mismatch_score{-2}}} |
                   seqan3::align_cfg::gap{seqan3::gap_scheme{seqan3::gap_score{-4}}} |

include/seqan3/alignment/configuration/align_config_edit.hpp

@@ -49,7 +49,7 @@ namespace seqan3::align_cfg
  * trigger the slower algorithm which can handle the case if the ends are free in the second sequence instead of the
  * first sequence.
  */
-inline constexpr configuration edit = method_global | scoring{nucleotide_scoring_scheme{}} |
+inline constexpr configuration edit = method_global{} | scoring{nucleotide_scoring_scheme{}} |
                                       gap{gap_scheme{gap_score{-1}}};
 
 } // namespace seqan3

include/seqan3/alignment/configuration/align_config_method.hpp

@@ -23,15 +23,6 @@
 namespace seqan3::detail
 {
 
-//!\brief A strong type to select the global alignment method.
-//!\ingroup alignment_configuration
-struct method_global_tag : public pipeable_config_element<method_global_tag>
-{
-    //!\privatesection
-    //!\brief An internal id used to check for a valid alignment configuration.
-    static constexpr detail::align_config_id id{detail::align_config_id::global};
-};
-
 //!\brief A strong type to select the local alignment method.
 //!\ingroup alignment_configuration
 struct method_local_tag : public pipeable_config_element<method_local_tag>
@@ -108,6 +99,55 @@ struct free_end_gaps_sequence2_trailing : public seqan3::detail::strong_type<boo
  * \ingroup alignment_configuration
  * \copydetails seqan3::align_cfg::method_local
  */
-inline constexpr seqan3::detail::method_global_tag method_global{};
+struct method_global : public pipeable_config_element<method_global>
+{
+    /*!\name Constructors, destructor and assignment
+     * \{
+     */
+    method_global() = default; //!< Defaulted.
+    method_global(method_global const &) = default; //!< Defaulted.
+    method_global(method_global &&) = default; //!< Defaulted.
+    method_global & operator=(method_global const &) = default; //!< Defaulted.
+    method_global & operator=(method_global &&) = default; //!< Defaulted.
+    ~method_global() = default; //!< Defaulted.
+
+    /*!\brief Construct method_global with a specific free end gap configuration.
+     * \param[in] free_sequence1_leading An instance of seqan3::align_cfg::free_end_gaps_sequence1_leading that
+     *                                   indicates whether leading gaps in sequence1 should be freed (not penalised)
+     *                                   `true` or not `false`;
+     * \param[in] free_sequence2_leading An instance of seqan3::align_cfg::free_end_gaps_sequence2_leading that
+     *                                   indicates whether leading gaps in sequence2 should be freed (not penalised)
+     *                                   `true` or not `false`;
+     * \param[in] free_sequence1_trailing An instance of seqan3::align_cfg::free_end_gaps_sequence1_trailing that
+     *                                   indicates whether trailing gaps in sequence1 should be freed (not penalised)
+     *                                   `true` or not `false`;
+     * \param[in] free_sequence2_trailing An instance of seqan3::align_cfg::free_end_gaps_sequence2_trailing that
+     *                                   indicates whether trailing gaps in sequence2 should be freed (not penalised)
+     *                                   `true` or not `false`;
+     */
+    constexpr method_global(seqan3::align_cfg::free_end_gaps_sequence1_leading free_sequence1_leading,
+                            seqan3::align_cfg::free_end_gaps_sequence2_leading free_sequence2_leading,
+                            seqan3::align_cfg::free_end_gaps_sequence1_trailing free_sequence1_trailing,
+                            seqan3::align_cfg::free_end_gaps_sequence2_trailing free_sequence2_trailing) noexcept :
+        free_end_gaps_sequence1_leading{free_sequence1_leading.get()},
+        free_end_gaps_sequence2_leading{free_sequence2_leading.get()},
+        free_end_gaps_sequence1_trailing{free_sequence1_trailing.get()},
+        free_end_gaps_sequence2_trailing{free_sequence2_trailing.get()}
+    {}
+    //!\}
+
+    //!\brief If set to `true`, leading gaps in sequence1 are not penalized when computing the optimal alignment.
+    seqan3::align_cfg::free_end_gaps_sequence1_leading free_end_gaps_sequence1_leading{false};
+    //!\brief If set to `true`, leading gaps in sequence2 are not penalized when computing the optimal alignment.
+    seqan3::align_cfg::free_end_gaps_sequence2_leading free_end_gaps_sequence2_leading{false};
+    //!\brief If set to `true`, trailing gaps in sequence1 are not penalized when computing the optimal alignment.
+    seqan3::align_cfg::free_end_gaps_sequence1_trailing free_end_gaps_sequence1_trailing{false};
+    //!\brief If set to `true`, trailing gaps in sequence2 are not penalized when computing the optimal alignment.
+    seqan3::align_cfg::free_end_gaps_sequence2_trailing free_end_gaps_sequence2_trailing{false};
+
+    //!\privatesection
+    //!\brief An internal id used to check for a valid alignment configuration.
+    static constexpr detail::align_config_id id{detail::align_config_id::global};
+};
 
 } // namespace seqan3::align_cfg

include/seqan3/alignment/pairwise/alignment_configurator.hpp

@@ -131,7 +131,7 @@ struct alignment_contract
     //!\brief Expects alignment configurations.
     constexpr static bool expects_alignment_configuration()
     {
-        const bool is_global = alignment_config_type::template exists<seqan3::detail::method_global_tag>();
+        const bool is_global = alignment_config_type::template exists<seqan3::align_cfg::method_global>();
         const bool is_local = alignment_config_type::template exists<seqan3::detail::method_local_tag>();
 
         return (is_global || is_local);
@@ -317,7 +317,7 @@ struct alignment_configurator
             auto const & scoring_scheme = get<align_cfg::scoring>(cfg).value;
             auto align_ends_cfg = config_with_result_type.get_or(align_cfg::aligned_ends{free_ends_none}).value;
 
-            if constexpr (config_t::template exists<seqan3::detail::method_global_tag>())
+            if constexpr (config_t::template exists<seqan3::align_cfg::method_global>())
             {
                 // Only use edit distance if ...
                 if (gaps.get_gap_open_score() == 0 &&  // gap open score is not set,
@@ -550,7 +550,7 @@ constexpr function_wrapper_t alignment_configurator::configure_scoring_scheme(co
                                 typename traits_t::score_type,
                                 typename traits_t::scoring_scheme_alphabet_type,
                                 typename std::conditional_t<traits_t::is_global,
-                                                            seqan3::detail::method_global_tag,
+                                                            seqan3::align_cfg::method_global,
                                                             seqan3::detail::method_local_tag>>,
                             typename traits_t::scoring_scheme_type>;